EBV Mutation Detail Information

> E326Q Search Result


Mutation Information
Mutation Site E326Q
Mutation Type Amino acid level
Gene/Protein/Region Type LMP1
Country Japanese
Literature Information
PubMed PMID 16917737
Disease NK/T cell lymphoma
Published Year 2007
Journal Virus genes
Title Sequence variations of Epstein-Barr virus LMP1 gene in nasal NK/T-cell lymphoma.
Author Nagamine M,Takahara M,Kishibe K,Nagato T,Ishii H,Bandoh N,Ogino T,Harabuchi Y
Evidence The amino acid changes at codon 309 (Ser to Asn), 322 (Gln to Asn) and 326 (Glu to Gln), were found in all, 6 (86%) and 3 (43%) of 7 patients, respectively. In addition, the amino acid Table 1 The sequences and coordinates of PCR primers Transcript Primersa Sequence (5-3) B95-8 genomic coordinates LMP1 1S (s) CTTTCCTCAACTGCCTTGCT 169514169495 1MS (s) ATTATTGCTCTCTATCTACAACAA 168858168835 1ME (as) TCATCACTGTGTCGTTGTCC 168740168759 1E (as) TCCCAGTAAATGGAGGGAGAGTCA 168091168114 a The sense (s) or antisense (as) orientation is indicated in brackets Virus Genes (2007) 34:4754 49 123 change at codon 322 (Gln to Thr), 328 (Glu to Asp) and 329 (Asn to His) were detected in each one patient.

Contents
Description
Mutation Information Note
  • Gene/Protein/Region Type: Virus Gene (e.g. LMP-1) or Virus Protein (e.g. Rep 68) or Virus Region (e.g. S, X)
Literature Information Note
  • Evidence: sentence contains this mutation information in the citation