|
Basic Characteristics of Mutations
|
|
Mutation Site
|
E326Q |
|
Mutation Site Sentence
|
The amino acid changes at codon 309 (Ser to Asn), 322 (Gln to Asn) and 326 (Glu to Gln), were found in all, 6 (86%) and 3 (43%) of 7 patients, respectively. In addition, the amino acid Table 1 The sequences and coordinates of PCR primers Transcript Primersa Sequence (5-3) B95-8 genomic coordinates LMP1 1S (s) CTTTCCTCAACTGCCTTGCT 169514169495 1MS (s) ATTATTGCTCTCTATCTACAACAA 168858168835 1ME (as) TCATCACTGTGTCGTTGTCC 168740168759 1E (as) TCCCAGTAAATGGAGGGAGAGTCA 168091168114 a The sense (s) or antisense (as) orientation is indicated in brackets Virus Genes (2007) 34:4754 49 123 change at codon 322 (Gln to Thr), 328 (Glu to Asp) and 329 (Asn to His) were detected in each one patient. |
|
Mutation Level
|
Amino acid level |
|
Mutation Type
|
Nonsynonymous substitution |
|
Gene/Protein/Region
|
LMP-1 |
|
Standardized Encoding Gene
|
LMP-1
|
|
Genotype/Subtype
|
- |
|
Viral Reference
|
-
|
|
Functional Impact and Mechanisms
|
|
Disease
|
Lymphoma, Extranodal NK-T-Cell
|
|
Immune
|
- |
|
Target Gene
|
-
|
|
Clinical and Epidemiological Correlations
|
|
Clinical Information
|
- |
|
Treatment
|
- |
|
Location
|
Japan |
|
Literature Information
|
|
PMID
|
16917737
|
|
Title
|
Sequence variations of Epstein-Barr virus LMP1 gene in nasal NK/T-cell lymphoma
|
|
Author
|
Nagamine M,Takahara M,Kishibe K,Nagato T,Ishii H,Bandoh N,Ogino T,Harabuchi Y
|
|
Journal
|
Virus genes
|
|
Journal Info
|
2007 Jan;34(1):47-54
|
|
Abstract
|
Nasal natural killer (NK)/T-cell lymphoma is a peculiar lymphoma with an unique immunophenotype. Etiologically, the authors previously first demonstrated the presence of Epstein-Barr virus (EBV) genomes and their products in this lymphoma (Lancet 1990; 335). It is suggested that some of sequence variations such as a 30-bp deletion and multiple base substitutions and as amino acid changes at HLA-A2 restricted CTL epitopes were associated with an increase in tumorigenicity and with a decrease in immune recognition. In this study, we determined full-length of LMP1 sequence isolated from 7 patients with nasal NK/T-cell lymphoma using polymerase chain reaction (PCR) method and compared the sequences with those referred to previous reports. In the carboxyl-terminal site, all 7 patients showed 4 copies of the 11 amino acids repeat (codon 254-302) and 30-bp deletion corresponding to codon 343-352 of the B95-8 strain. Within the NF-kB-activating domains, all 7 patients showed amino acid changes at codon 189 (Gln to Pro), 192 (Ser to Thr) and 212 (Gly to Ser) on either site of the PXQXT (codon 204-208) motif. In the major HLA-A2 restricted T-cell epitope sequence YLLEMLWRL (codon 125-133), all 7 patients showed amino acid changes at codon 126 (Leu to Phe) and 129 (Met to Ile). In the epitopes ALLVLYSFA (codon 51-59), VLFIFGCLL (codon 110-118) and WLLLFLAIL (codon 173-181), several patients showed novel amino acid changes at codon 59 (Ala to Gly), 110 (Val to Leu) and 174 (Leu to Ile), respectively. Although it is still not clear what the most specific and biologic variation of LMP1 gene in nasal NK/T-cell lymphoma is, the sequence data may be valuable on the study for pathogenesis of nasal NK/T-cell lymphoma and EBV molecular epidemiology.
|
|
Sequence Data
|
-
|
|
|